Genetic Fertility Treatment in India – Get a Free Quote by We Care India Fertility Clinics

FOR IMMEDIATE RELEASE
(Free-Press-Release.com) April 26, 2010 -- What is DNA?

DNA (deoxyribose nucleic acid) is a code inside cells to tell the body what it needs to function and what to look like. The code is made up of 4 different chemical units called bases. The bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The code, if you were to read it, would look something like this: ...CGTAGCTTACTTTAGGCTAGCAAACGCATC....

What are Chromosomes?

Packaging the DNA into chromosomes ensures that the genetic material is copied and distributed evenly when a cell divides. Chromosomes can only be seen under the microscope when a cell is dividing.


Genetic Mistakes
Gene errors Sometimes mistakes can happen in the copying of the code when a cell divides:

* Gene deletion
o A section of the DNA can be missed out
GTCAACTGATCGATCGGATCGA
GTCAAC___TCGATCGGATCGA Gene mutation
*
o The wrong base might be copied
GTCAACTGATCGATCGGATCGA
GTCAACTGCTCGATCGGATCGA ..........





Please log on to : - http://www.ivfsurrogacy.com/genetic_treatments.htm

Please log on to : - http://www.ivfsurrogacy.com/ivf_surrogacy_medical_quote.htm


We Care Core Values

"We have a very simple business model that keeps you as the centre."


Having the industry’s most elaborate and exclusive Patient Care and Clinical Coordination teams stationed at each partner hospital, we provide you the smoothest and seamless care ever imagined. With a ratio of one Patient Care Manager to five patients our patient care standards are unmatched across the sub continent.

Genetic Infertility Cost India     Genetic Infertility Hospital     Genetic Infertility Treatment